Molecular diagnostics and cell genetics

Instructions:

-Please read each multiple choice, true/false, or short answer question carefully. Answer short-answer questions completely but please be concise. Points maybe deducted for excessive wordiness or if additional information not relevant to the question is given.

-Highlight the correct answer for multiple choice questions in yellow. Also highlight all other answers (short answer, True/False, etc) in yellow.

– You could use the attched “Merged lectures” as a source, or you could use you own sources.

Questions:

List the following in order from smallest to largest based on size of the molecule, region or structure: 1p, 6q26, base pair, chromosome 1, chromosome 22, codon, diploid human genome, exon, gene, haploid human genome, intron, nucleoside, nucleotide, purine base, pyrimidine base
Translation starts and finishes within the portion of the mRNA sequence below from the hypothetical gene, XYZ. Give the predicted amino acid sequence (single-letter or three-letter abbreviations).
CUUGAAUUCUUUGAACGAACAUCGAUGAGUGUUCCAAGAGGGGCACUUCAUCACUAGUCUACCGUCUAU

The gene above is sequenced in a patient A and patient B, both suspected of having a genetic disease caused by mutations in this gene. Describe the variant/mutation found in each patient and classify each with using the following terms when appropriate (SNV, CNV, nonsense, missense, silent, frameshift, in-frame, deletion, insertion, transition, transversion, inversion, translocation, trisomy, monosomy, amplification)
patient A:

CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCATGAGGGGCACTTCATCACTAGTCTACCGTCTAT

patient B:
CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCACGAGGGGCACTTCATCACTAGTCTACCGTCTAT

Based on the information provided in the previous question, is it more likely that patient A or patient B has the genetic disease associated with XYZ? Why?

At a particular locus, how many alleles could you have in common with a sibling (same biological parents)?
1
2
1 or 2
0, 1 or 2

List three components or molecules needed for transcription.
List three ways RNA differs from DNA.

Which best describes “redundancy” of the genetic code?
all organism use the same genetic code
a single amino acid can be coded for by multiple codons
the use of RNA as an intermediate in the genetic code evolved separately in different organisms
The same nucleotide is often repeated several times in the exons of protein coding genes

Which components can be found within exons?
stop codons and introns
promoters and start codons
polyadenylation signal and stop codon
poly-A tail and 5’ untranslated region

Which could be found in an intron?
missense mutation
benign SNV
nonsense mutation
stop codon

Describe the difference between a missense and frameshift variant. What is the impact of each on the DNA sequence and protein sequence?
Which term could be used to describe the variant, “c.135A>C”?
silent
deletion
transition
inversion

Sequencing of cancer tissue reveals a somatic variant/mutation involving a tumor suppressor gene. Which term would most likely describe this variant?
deletion
amplification
silent
chimeric

DNA is extracted from two peripheral whole blood specimens and evaluated by UV spectrophotometry. Give the absorbance measurements below, which sample might be less suitable for PCR testing?
sample #1: 260 nm = 0.85; 280 nm = 1.6
sample #2: 260 nm = 0.61; 280 nm = 0.32

What explanation gives the most convincing explanation for the condition of the less suitable DNA sample in the previous question?
Storage of the DNA samples for more than one month at room temperature
Exposure of the sample to ionizing radiation
Contaminating RNA
Eluting DNA with too much TE buffer
Insufficient washing of magnetic beads during DNA extraction

All of the following are required for both PCR and Southern blotting EXCEPT:
enzyme
hybridization
target amplification
DNA being tested

In traditional (endpoint) PCR, why is testing usually not finished immediately after thermal cycling?

A PCR is performed to amplify a target sequence in genomic DNA prior to Sanger sequencing for 200 different patient samples. The PCR works as expected for all but one sample (John Doe) in which the target sequence did not amplified. Which explanation makes most sense?
John Doe’s DNA sample was isolated from blood drawn in a sodium heparin (green-top) tube.
John Doe’s DNA sample was isolated from frozen tissue
John Doe’s DNA sample became contaminated with PCR product (amplicon) from the last time the same PCR was run
A negative control was not run

List 3 ways the set-up and running of real-time PCR differs from traditional/endpoint PCR.

List 3 things real-time PCR and traditional/endpoint PCR have in common.

List 3 benefits of real-time PCR over traditional PCR.

Give the values from figure above:
Ct:
threshold: _
Number of PCR cycles: __
Which is true of real-time PCR with Taqman probes?
It requires a polymerase with 5’-3’ endonuclease activity
Two different oligonucleotide probes are required
Increased specificity over SYBR green real-time PCR
All of the above

Which is true of performing real-time PCR with SYBR green?
besides the two primers, no other oligonucleotides are needed
it requires fluorescent detection
it can be cheaper than other real-time PCR methods
All of the above

A couple has a child with cystic fibrosis and later has another child that does not have cystic fibrosis. What is the probability the second child is a carrier?
100%
66%
50%
25%
0%
A newborn child is diagnosed with cystic fibrosis and Tay Sachs disease, two autosomal recessive diseases. Both parents are evaluated and neither has symptoms of either disease. Which scenario best explains the child’s condition?
Neither parent harbors mutations for cystic fibrosis or Tay Sachs. The mutations in the child occurred de novo.
Both parents are compound heterozygotes.
Both parents are double heterozygotes.
The child is male and the genes mutated are both on the X chromosome.

If a man in known to be a carrier for the deltaF508 mutation in the CFTR gene and his partner is tested for the deltaF508 mutation and it is not detected, the couple can be assured they won’t have a child with cystic fibrosis.
True
False

The xTAG Cystic Fibrosis Assay uses a multiplex PCR because
the CFTR gene is so large
the assay must detect a large number of mutations
CFTR mutations are relatively common in the Caucasian population
there are a large number of pathogenic organisms that tend to colonize the lungs of CF patients

Recently, several rapid, single sample molecular tests have been approved for infectious disease testing but this trend does not seem to be as common for genetic testing. Why?
Bacteria and viruses replicate quickly making them easier to detect by PCR than human genomic targets.
DNA from microbes has more repetitive sequences which makes it a better target for PCR.
Microbial genomes are generally much smaller than the human genomes.
Reporting results in hours instead of days for genetic testing does not impact patient care as much as for molecular infectious disease testing.

BG2 is a human gene that is used as an internal control in the GeneXpert MRSA PCR. The reason that BG2 is used is…
To ensure proper specimen collection and help rule-out a false-negative due to PCR inhibitors
to distinguish human specimens from animal specimens since MRSA infections are common in pets and farm animals
the test is performed in a single-sample cartridge. Separate MRSA-positive batch controls are not possible.
to make the test quantitative

Which statement is true concerning HPV and cervical cancer
All HPV infections lead to cervical cancer
All cervical cancers are associated with HPV
HPV-associated cervical cancer is more deadly than cervical cancer not associated with HPV
HPV 6, 11, 42, 43 and 44 are most closely associated with cervical cancer

Quantitative viral testing…
is rarely clinically relevant
can be performed by real-time PCR with a standard curve
is possible with real-time PCR but rarely uses Ct values
is possible with real-time PCR but require SYBR green
All of the following are associated with microarrays EXCEPT:
probes
multiplexing
hybridization
real-time PCR

Which is not a common application of microarray technology
Next generation sequencing
genotyping
gene expression
CNV detection

What is one advantage that chromosomal microarrays (CMAs) have over traditional karyotype?
higher resolution
better detection of translocations
fewer variants of uncertain significance
can detect novel point mutations

List 4 abnormalities that can be detected with SNP-based CMAs.

Why is there a shift from three tracks to two in the allele peaks (SNP data) in the CMA data shown below?
Long stretches of homozygosity detected by a SNP-based CMA could indicate all of the following EXCEPT
consanguinity
chimerism
uniparental disomy
risk for autosomal recessive diseases
A Sanger sequencing reaction includes many of the same components as PCR. In which ways are the two similar?
ddNTPs
exponential amplification
two primers per reaction
thermal cycling
all of the above

A germline mutation can be detected in
sperm or eggs
blood
breast tissue
tumor tissue
all of the above
An increased depth of coverage in next-generation sequencing is generally associated with
more genes being sequenced
increased sensitivity for low-level variants
sequencing all the exons in a gene
increased rates of false-positives
At a given position in an exon included in a next-generation sequencing panel, the nucleotide G is detected in 1483 reads and ‘A’ is detected in 164 reads. The ‘A’ allele is most likely…
a germline variant
a somatic variant
part of a microbial genome sequence
benign
Next-generation sequencing reveals a variant in an unfamiliar gene. What should you do to better understand the variant?
Determine the effect of the variant on the gene and its protein
Check OMIM.org for information about the gene and its function
Search PubMed for articles on the gene and variant
Query databases to see if the variant has been seen previously in normal or affected individuals
all of the above
CLIA is an organization with many responsibilities, including assisting the FDA decide which laboratory tests should be reimbursed by Medicare.
True
False
CAP and The Joint Commission are two organizations that can certify clinical labs.
True
False

Proficiency testing is…
required for high complexity testing only
is required for CAP-certified labs only
performed when validating tests and when controls fall out of range
mandated by CLIA
Waived tests…
Do not need to be reviewed by the FDA before they are sold commercially
include most lab-developed tests
must be performed by someone with a bachelor’s degree or higher
all of the above
none of the above
CAP inspects laboratories based on regulations specified in CLIA.
True
False
What organization determines test complexity?
FDA
CLIA
CLIAC
CMS

CLIA addresses all of the following EXCEPT…
requirements for report format
lab design
proficiency testing
requirements for IVDs being submitted as PMA
educational requirements for medical directors
Enforcement discretion refers to…
FDA’s decisions to inspect some labs on an annual basis and others less frequently
FDA oversight of lab developed tests
CLIA’s decisions to penalize labs for failed proficiency testing
FDA’s policy not to interfere with labs that decide to sell test reagents to other labs
Which of the following is not a medical device
MRI instrument
home pregnancy test
chemotherapy agent
catheter

An IVD that is FDA-cleared
is also FDA-approved
was found perform similar to and FDA-approved IVD
went through a more extensive clinical trial than and FDA-approved IVD
must have had a clinical trial comparing patient test results to their clinical data

A monoclonal antibody
is will bind multiple epitopes
is purified from serum of animals
requires fused cells
all of the above

In competitive immunoassays the
product measured is inversely proportional to the antigen concentration
product measured is proportional to the antigen concentration
hook effect can be seen when the product is present at low concentrations
none of the above